tanylabrooks tanylabrooks

02-04-2021
Mathematics

contestada

A cone and its dimension are shown in the diagram. Find the volume of the cone in cubic feet.

A cone and its dimension are shown in the diagram Find the volume of the cone in cubic feet class=

Respuesta :

emy0san emy0san

02-04-2021

Answer:

[tex]\pi/4[/tex]

Step-by-step explanation:

The volume of a cone is [tex]\pi r^2h/3[/tex]. We have that [tex]r=1[/tex] and [tex]h=3/4[/tex]. Therefore, the volume is [tex]\pi/4[/tex].

Answer Link

Otras preguntas

Simplify the expression completely. x squared over x to the power of 6

PLEASE HELP!!!!!!!!!!!!!!! Mongol conquests ranged from East Asia to Eastern Europe during the thirteenth and fourteenth centuries. This relatively short period

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in

What two molecules are produced by the light reactions and used to power the calvin cycle?

Explain the significance of the phoenix. what, according to granger, makes humans different from the phoenix?

Arrange the complex numbers in order according to the quadrant in which they appear, starting with the first quadrant. Tiles: 3 − 4i -1 − 3i 4 + i -2 + 2i

Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2

Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new

Many worship services include a speech given by a church leader. this speech is called a